Journal: Journal of Biomedical Science

Article Title: USP9X-mediated REV1 deubiquitination promotes lung cancer radioresistance via the action of REV1 as a Rad18 molecular scaffold for cystathionine γ-lyase

doi: 10.1186/s12929-024-01044-3

Figure Lengend Snippet: REV1 downregulates CTH expression by promoting Rad18 binding and ubiquitinating CTH for degradation. A Heatmap generated from the results of enrichment of Gly/Ser/Thr signaling pathways in RNA sequencing. B REV1 was knocked down in A549 and H1299 cells, and the relative mRNA levels of CTH were detected by RT-PCR. *** P < 0.001, ( n = 3). C A549, H1299, and H1975 cells were transfected with siREV1, and the expression of the corresponding antibody was detected by Western blotting after 48 h ( n = 3). D DMSO and JH-RE-06-treated A549, H1299, and H1975 cells were harvested and CTH expression was detected by Western blotting ( n = 3). E-F Endogenous interaction of CTH with REV1 and Rad18 in A549 cells and H1299 cells. G Proteins of HEK293T cells transfected with Flag-Rad18 were collected and added to GST-only and GST-CTH fusion proteins, respectively. The expression of the corresponding molecules was detected by Western blotting after overnight enrichment and elution ( n = 3). H A549, H1299, and H1975 cells were transfected with siRad18, and the expression of the corresponding proteins was detected by Western blotting after 48 h ( n = 3). I Scrambled and Rad18-deleted A549 cells were treated with DMSO or MG132 for 4 h before protein collection, and the expression of the indicating molecules was examined by Western blotting ( n = 3). J Cells were transfected with the corresponding plasmids and siRNA, MG132 was added 4 h before protein collection treatment, and the in vitro CTH ubiquitination level was detected using the immunoprecipitation technique ( n = 3). K Left panel: Scrambled and Rad18-deleted A549 cells were treated with CHX (20 µg/mL). Cellular proteins were collected at the corresponding times, and the protein levels of CTH were detected by Western blotting ( n = 3). Right panel: quantitative statistical analysis of CTH protein ( n = 3). L Proteins of HEK-293T cells transfected with the corresponding plasmids were harvested and incubated with GST-only or GST-CTH fusion proteins overnight and analyzed by Western blotting ( n = 3). M-N A549 and H1975 cells were transfected with the corresponding siRNA or plasmid and analyzed by Western blotting using the corresponding antibodies ( n = 3)

Article Snippet: The main antibodies and reagents used in this study are as follows: mouse anti-REV1 (Santa Cruz, sc-393022, 1:100), rabbit anti-USP9X (Proteintech, 55054-1-AP, 1:1000), rabbit anti-CTH (Abcam. ab151769, 1:1000), mouse anti-GAPDH (ABclonal, AC033, 1:3000), rabbit anti-Rad51 (Abcam, ab133534, 1:1000), rabbit anti-USP24 (Proteintech, 13126 -1-AP, 1:1000), rabbit anti-USP5 (Proteintech, 10473-1-AP, 1:1000), rabbit anti-USP1 (Proteintech, 14346-1-AP, 1:1000), rabbit anti-USP14 ( Proteintech, 14517-1-AP, 1:1000), rabbit anti-UCHL5 (Proteintech, 11527-1-AP, 1:1000), mouse anti-Flag (Sigma-Aldrich, F1804, 1:3000), rabbit anti-GST (Abcolonal, AE006, 1:1000), rabbit anti-HA (Cell Signaling Technology, #3724, 1:3000), Ubiquitination Compound Library (Selleck, L6000), JH-RE-06 (Topscience, T15611), MG132 (Calbiochem, 474,790) and cycloheximide (Sigma-Aldrich, A8244).

Techniques: Expressing, Binding Assay, Generated, Protein-Protein interactions, RNA Sequencing, Reverse Transcription Polymerase Chain Reaction, Transfection, Western Blot, In Vitro, Ubiquitin Proteomics, Immunoprecipitation, Incubation, Plasmid Preparation

Journal: Journal of Biomedical Science

Article Title: USP9X-mediated REV1 deubiquitination promotes lung cancer radioresistance via the action of REV1 as a Rad18 molecular scaffold for cystathionine γ-lyase

doi: 10.1186/s12929-024-01044-3

Figure Lengend Snippet: USP9X positively regulates REV1 expression through the ubiquitin-proteasome system pathway. A Protein extracted from A549 and H1299 lung cancer cells after 4 h of MG132 treatment and protein expression of REV1 detected by Western blotting. B Flow chart of the ubiquitination compound library screening system. C The four drugs obtained from the screening that inhibited REV1 protein expression most significantly were used to treat A549 cells for 24 h. The proteins were extracted, and the expression of REV1 protein was detected by Western blotting. D The targets of the four small-molecule drugs obtained from the screening. Interaction between USP9X and REV1 ( n = 3). E Endogenous interaction between REV1 and small molecule drug targets. F A549 cells were transfected with SFB-REV1 plasmid, and the interaction between USP9X and REV1 was detected by co-IP assay after 24 h ( n = 3). G siUSP9X was transfected into A549 and H1299 lung cancer cells, and REV1 expression was detected by Western blotting after 48 h ( n = 3). H A549 cells were transfected with the corresponding plasmids for 24 h, treated with MG132 for 4 h before protein extraction, and treated with S beads for immunoprecipitation. I A549 cells were transfected with Scramble or siUSP9X for 48 h, DMSO or MG132 was added 4 h before protein extraction, and the expression of the corresponding proteins was detected by Western blotting ( n = 3). J Cells were transfected with the corresponding siRNA or plasmid, MG132 was added 4 h before protein extraction, and immunoprecipitation experiments were performed with S beads for immunoprecipitation experiments ( n = 3). K Left panel: A549 lung cancer cells transfected with scramble or siUSP9X for 48 h before CHX (100 µg/mL) treatment. Cellular proteins were collected at the corresponding times, and the protein levels of REV1 were detected by Western blotting ( n = 3). Right panel: quantitative statistical analysis of REV1 protein ( n = 3)

Article Snippet: The main antibodies and reagents used in this study are as follows: mouse anti-REV1 (Santa Cruz, sc-393022, 1:100), rabbit anti-USP9X (Proteintech, 55054-1-AP, 1:1000), rabbit anti-CTH (Abcam. ab151769, 1:1000), mouse anti-GAPDH (ABclonal, AC033, 1:3000), rabbit anti-Rad51 (Abcam, ab133534, 1:1000), rabbit anti-USP24 (Proteintech, 13126 -1-AP, 1:1000), rabbit anti-USP5 (Proteintech, 10473-1-AP, 1:1000), rabbit anti-USP1 (Proteintech, 14346-1-AP, 1:1000), rabbit anti-USP14 ( Proteintech, 14517-1-AP, 1:1000), rabbit anti-UCHL5 (Proteintech, 11527-1-AP, 1:1000), mouse anti-Flag (Sigma-Aldrich, F1804, 1:3000), rabbit anti-GST (Abcolonal, AE006, 1:1000), rabbit anti-HA (Cell Signaling Technology, #3724, 1:3000), Ubiquitination Compound Library (Selleck, L6000), JH-RE-06 (Topscience, T15611), MG132 (Calbiochem, 474,790) and cycloheximide (Sigma-Aldrich, A8244).

Techniques: Expressing, Ubiquitin Proteomics, Western Blot, Drug discovery, Transfection, Plasmid Preparation, Co-Immunoprecipitation Assay, Protein Extraction, Immunoprecipitation

Journal: Journal of Biomedical Science

Article Title: USP9X-mediated REV1 deubiquitination promotes lung cancer radioresistance via the action of REV1 as a Rad18 molecular scaffold for cystathionine γ-lyase

doi: 10.1186/s12929-024-01044-3

Figure Lengend Snippet: Schematic. Left: REV1 induces metabolic abnormalities involved in the development of radioresistance in lung cancer. USP9X mediates REV1 deubiquitination to stabilize its expression in lung cancer. Aberrantly expressed REV1 acts as a scaffolding protein to assist the E3 ubiquitin ligase Rad18 in interacting with CTH, promoting CTH ubiquitination degradation and upregulating intra- and extracellular Gly/Ser/Thr levels, leading to lung cancer radiotherapy resistance. Right: Therapeutic potential of targeting REV1 in lung cancer. JH-RE-06 promotes the formation of loss-of-function dimers of REV1 and induces remodeling of intra- and extracellular amino acid metabolism, thereby enhancing the radiosensitivity of lung cancer cells

Article Snippet: The main antibodies and reagents used in this study are as follows: mouse anti-REV1 (Santa Cruz, sc-393022, 1:100), rabbit anti-USP9X (Proteintech, 55054-1-AP, 1:1000), rabbit anti-CTH (Abcam. ab151769, 1:1000), mouse anti-GAPDH (ABclonal, AC033, 1:3000), rabbit anti-Rad51 (Abcam, ab133534, 1:1000), rabbit anti-USP24 (Proteintech, 13126 -1-AP, 1:1000), rabbit anti-USP5 (Proteintech, 10473-1-AP, 1:1000), rabbit anti-USP1 (Proteintech, 14346-1-AP, 1:1000), rabbit anti-USP14 ( Proteintech, 14517-1-AP, 1:1000), rabbit anti-UCHL5 (Proteintech, 11527-1-AP, 1:1000), mouse anti-Flag (Sigma-Aldrich, F1804, 1:3000), rabbit anti-GST (Abcolonal, AE006, 1:1000), rabbit anti-HA (Cell Signaling Technology, #3724, 1:3000), Ubiquitination Compound Library (Selleck, L6000), JH-RE-06 (Topscience, T15611), MG132 (Calbiochem, 474,790) and cycloheximide (Sigma-Aldrich, A8244).

Techniques: Expressing, Scaffolding, Ubiquitin Proteomics

Journal: Redox Biology

Article Title: Nuclear pore complex dysfunction drives TDP-43 pathology in ALS

doi: 10.1016/j.redox.2025.103824

Figure Lengend Snippet: ALS is associated to altered nucleoporin content in spinal cord and brain cortex . A) Left panel shows a representative western-blot image of FG-repeats containing NUPs (reactive to monoclonal antibody MAb414) of lumbar spinal cord homogenates from ALS patients and healthy, age and sex matched controls. Right panel shows the quantified immunoreactivity. B) The left panel shows representative confocal microscopy images from isolated nuclei from spinal cord samples, quantified in the violin plots from the right panel, demonstrating in situ decreased nucleoporin content.C) Quantitative analyses of NUP107, FG-repeats, and NUP93 in isolated nuclei by flow cytometry analyses, showing decreased content of NUP107 in spinal cord samples from ALS patients. D) RNA Seq data in heatmap showing that the mRNAs content of scaffold NUPs and NUP153 (an FG-repeat containing NUP) was decreased in spinal cord from ALS patients.Right panel indicates TPM (transcrits per kilobase million). E) Left panel shows confocal microscopy images with anti-tubulin β III immunoreactivity in nuclei isolated from brain cortex (area 8) from ALS patients and healthy individuals. Middle panel indicates tubulin β III content distribution, with the vertical line situating median values. Right panel illustrates differences in relationship between the content of FG-repeat NPC and tubulin β III in nuclei, with reference to ALS and tubulin β III content. F) Left panel shows representative confocal microscopy images from isolated nuclei from spinal cord samples, quantified plots from the right panel, demonstrating a decreased amount of nuclei from neuronal cells, based on NeuN content. Bars show mean values ± SEM or % in F. ∗,∗∗, and ∗∗∗∗ indicate p < 0.05, p < 0.01 and p < 0.0001 with reference to control values by Student's T test, Chi-Square (F) or Mann-Whitney U test. In E) For controls, linear relationship equation Y = −0.2721∗X + 0.01782 (p < 0.0004) and for ALS, the equation is Y = 0.3195∗X + 0.008008 (p < 0.0001). Scale white bar length in B, E and F are 50 μm long. Ns: non statistically significant differences.

Article Snippet: To investigate the role of specific NUPs, CRISPR/Cas9 constructs targeting NUP107 were designed using guide RNAs against human NUP107 gene (Santa Cruz Biotechnology, Dallas, TX, US, Cat #sc-405252-KO-2).

Techniques: Western Blot, Confocal Microscopy, Isolation, In Situ, Flow Cytometry, RNA Sequencing, Control, MANN-WHITNEY

Journal: Redox Biology

Article Title: Nuclear pore complex dysfunction drives TDP-43 pathology in ALS

doi: 10.1016/j.redox.2025.103824

Figure Lengend Snippet: NUPs are present in motor neurons and glial cells in human lumbar spinal cord, ventral horn. Representative immunohistochemical images of cellular distribution of the scaffolding NUP TPR (A–D) and the FG-repeat NUP107 (E,F). Samples from grey matter are shown in A,B,E and F, while as white matter cells (i.e. glial cells) are shown in C and D. Samples from healthy donors (A,C and E) and ALS patients (B,D and F) are presented. Arrows in A and B indicate non-nuclear staining of TPR, which were more frequent in ALS samples.

Article Snippet: To investigate the role of specific NUPs, CRISPR/Cas9 constructs targeting NUP107 were designed using guide RNAs against human NUP107 gene (Santa Cruz Biotechnology, Dallas, TX, US, Cat #sc-405252-KO-2).

Techniques: Immunohistochemical staining, Scaffolding, Staining

Journal: Redox Biology

Article Title: Nuclear pore complex dysfunction drives TDP-43 pathology in ALS

doi: 10.1016/j.redox.2025.103824

Figure Lengend Snippet: NUP107 silencing alters autophagy and induces TDP-43 pathology in human cells . A) Left panel indicates representative western-blot of different NUPs in CRISPR-mediated NUP-107 silencing of HEK293 cells. Right panel shows densitometry analyses of different experiments. B) Left panel shows representative western-blot of different autophagy and protein-turnover components in the same cells, with right panel indicating densitometric analyses. C) Confocal microscopy of TDP-43 immunoreactivity of HEK293 CRISPR-mediated NUP107 cells, showing altered TDP-43 immunoreactivity, quantified in the lower panel.D) Confocal microscopy of phospho-TDP-43 immunoreactivity of CRISPR-mediated NUP107-silenced HEK293 cells, showing altered TDP-43 immunoreactivity, quantified in lower panel microscopy. E) Western-blot analyses of TDP-43 and phospho-TDP-43 in CRISPR-mediated NUP107-silenced HEK293 cells, quantified in the right panel. F) Higher magnification of confocal microscopy images showing cytosolic aggregates of phospho-TDP-43 (yellow arrows) induced by CRISPR-mediated NUP107-silencing in HEK293 cells, quantified in the left panel (both size and number of phospho-TDP-43 aggregates). G)Left panel, representative western-blot analyses of NUPs and autophagy components in siRNA-mediated silencing of NUP107 in HeLa cells.Right panel shows the quantitative analyses. Bars show mean values ± SEM from N = 3–5 different experiments. ∗,∗∗, ∗∗∗ and ∗∗∗∗ indicate, respectively, p < 0.05, p < 0.01, p < 0.001 and p < 0.0001 significant differences between silenced or non silenced cells by Student's T test or Mann Whitney U test. In B and D, white scale bar lenght is 50 μm long and 30 μm in F. ns: non statistically significant differences.

Article Snippet: To investigate the role of specific NUPs, CRISPR/Cas9 constructs targeting NUP107 were designed using guide RNAs against human NUP107 gene (Santa Cruz Biotechnology, Dallas, TX, US, Cat #sc-405252-KO-2).

Techniques: Western Blot, CRISPR, Confocal Microscopy, Microscopy, MANN-WHITNEY

Journal: Redox Biology

Article Title: Nuclear pore complex dysfunction drives TDP-43 pathology in ALS

doi: 10.1016/j.redox.2025.103824

Figure Lengend Snippet: Loss of TDP-43 induces alteration in nucleoporin homeostasis. A) Representative immunofluorescence analyses showing NUP107 and MAb414 in TDP-43 silenced cells for a HeLa inducible silencing clone. B) Violin plot showing the quantitative analyses of nuclear (i.e. colocalizing with DAPI) content of NUP107 and MAb414 of cells in A. C) Left panel, western-blot analyses of TPR-content in HeLa cells with inducible TDP-43 silencing, with right panel showing quantitative analyses. D) Western-blot analyses of selected NUPs and LC3B in HeLA cells with doxycycline-inducible TDP-43 silencing under autophagy induction by 24 h of nutrient deprivation (Depriv). E) Quantitative analyses of western-blots shown in D. Bars show mean values ± SEM from N = 3–5 different experiments. ∗,∗∗, and ∗∗∗∗ indicate, respectively, p < 0.05, p < 0.01, and p < 0.0001 significant differences between silenced or non silenced cells by Student's T test, Mann Whitney U test or post-hoc LSD after two-way ANOVA. In A white scale bar lenght is 50 μm long. ns: non statistically significant differences.

Article Snippet: To investigate the role of specific NUPs, CRISPR/Cas9 constructs targeting NUP107 were designed using guide RNAs against human NUP107 gene (Santa Cruz Biotechnology, Dallas, TX, US, Cat #sc-405252-KO-2).

Techniques: Immunofluorescence, Western Blot, MANN-WHITNEY

Journal: Cell

Article Title: Structural basis for transcript elongation control by NusG family universal regulators

doi: 10.1016/j.cell.2018.05.017

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Cryo-EM structures of a NusG- ops EC and an RfaH- ops EC For cryo-EM structure determination of the NusG- ops EC and RfaH- ops EC, we designed an RNA-DNA scaffold based on the A20 (20mer RNA transcript with A at the 3′-end) scaffold used previously for cryo-EM structure determination of an Eco EC ( Kang et al., 2017 ) except containing the ops sequence in the nt-DNA ( ).

Techniques: Recombinant, Mutagenesis, Variant Assay, Plasmid Preparation, Over Expression, Software, Electron Microscopy

Journal: Nature protocols

Article Title: Tracing DNA paths and RNA profiles in cultured cells and tissues with ORCA

doi: 10.1038/s41596-020-00478-x

Figure Lengend Snippet: Designing the Oligopaint library (boxed in black) takes less than a day and the library is typically shipped from IDT within a month of ordering. Synthesizing the primary probes (boxed in red) from the library is a two day process that involves turning double-stranded DNA (dsDNA) into single-stranded RNA (ssRNA), and then to single-stranded DNA (ssDNA). Sample preparation length (boxed in green) differs between embryos and cell culture. Embryo collection, embedding and cryosectioning takes two days. Adding cultured cells onto a poly-lysine charged coverslip and fixing the cells takes less than 30 minutes. Hybridizing RNA primary probe (boxed in cyan) can be done right after sample preparation. After the overnight hybridization step, the sample is ready to be imaged. Imaging acquisition (boxed in cyan) time depends upon the number of FOVs chosen and the number of barcodes in a region of interest. For example, if one were to image 18 FOVs and 10 RNAs for mESCs, this process would take ~9.5 hrs as imaging each RNA for 18 FOVs takes ~55 min. Typically for embryos, imaging ~50 FOVs and 29 RNAs takes 1.5 days. Hybridizing DNA primary probes (boxed in purple) is a 1.5 days process as there is an overnight step. Again, the imaging duration (boxed in purple) depends upon the number of FOVs and barcodes in a given experiment. For example, imaging a single barcode for 30 FOVs takes ~44 minutes each and an experiment with 55 barcodes will last approximately 1 day and 16 hrs. Another example is an experiment where one images 16 barcodes for 15 FOVs takes ~10 hrs. Thus, the span of time one could take to prepare a sample and image it (middle column) can be between 4–14 days. The duration of image analysis (boxed in yellow) depends upon the size of the data acquired. If the user wants to only look at DNA data, ChrTracer3 analysis can take approximately 1 day for a dataset for 75 barcodes and 34 FOVs in cell culture. Note, the number of nuclei imaged in 1 FOV for mESCs can range between 300–500 while the number of nuclei in 1 FOV for embryos is ~1600. Thus, analyzing mESCs data through ChrTracer3 will be quicker compared to embryos. Typically, analyzing embryo data through ChrTracer3 can range between 1–4 days depending upon the number of FOVs selected. If the user chooses to use all provided MATLAB software for DNA and RNA analysis (boxed in yellow), the process can take 4–8 days.

Article Snippet: Oligopaint library (CustomArray; see Procedure Step 1 for instructions on how to design the probes targeting RNA and/or DNA).

Techniques: Sample Prep, Cell Culture, Hybridization, Imaging, Software

Journal: Nature protocols

Article Title: Tracing DNA paths and RNA profiles in cultured cells and tissues with ORCA

doi: 10.1038/s41596-020-00478-x

Figure Lengend Snippet: a, Computational design of the Oligopaint library. The region of interest is partitioned into genomic segments (e.g. 2 kb or 10 kb) and each segment is assigned a minimum of twenty 40-nt target sequences. The following are taken into consideration for the oligonucleotides: GC content melting temperature, homology to barcode sequences, and repetitive sequences. Our MATLAB scripts take into account these constraints and tile the oligonucleotides across a genomic region of interest in a uniform manner. Each primary probeset from the oligopool has a unique forward (Fwd) and reverse (Rev) index primer sequence and a 20-nt reverse transcription (RT) sequence (catcaacgccacgatcagct) that will be used for probe synthesis. Additionally, the RT sequence serves as the fiducial probe binding sequence (Fid seq.), which will be used for drift-correction after data collection. b, Schematic of the primary probe synthesis. Unique primers allow for the amplification specific primary probes via limited-cycle PCR. Following the PCR, the double-stranded DNA (dsDNA) undergoes an in vitro transcription reaction to generate a bulk number of single-stranded RNAs (ssRNAs), which are converted back to single stranded DNA via a reverse transcription reaction. The DNA is then column purified, and the primary probes are concentrated.

Article Snippet: Oligopaint library (CustomArray; see Procedure Step 1 for instructions on how to design the probes targeting RNA and/or DNA).

Techniques: Sequencing, Reverse Transcription, Binding Assay, Amplification, In Vitro, Purification

Journal: Nature protocols

Article Title: Tracing DNA paths and RNA profiles in cultured cells and tissues with ORCA

doi: 10.1038/s41596-020-00478-x

Figure Lengend Snippet: Troubleshooting table

Article Snippet: Oligopaint library (CustomArray; see Procedure Step 1 for instructions on how to design the probes targeting RNA and/or DNA).

Techniques: Concentration Assay, Hybridization, Imaging, Adhesive, Labeling, Fluorescence, Binding Assay, Generated, Staining, Sequencing

Journal: Nature protocols

Article Title: Tracing DNA paths and RNA profiles in cultured cells and tissues with ORCA

doi: 10.1038/s41596-020-00478-x

Figure Lengend Snippet:

Article Snippet: Oligopaint library (CustomArray; see Procedure Step 1 for instructions on how to design the probes targeting RNA and/or DNA).

Techniques: Concentration Assay, Sequencing